ARS1007 Feature History Help

Sequence Annotation Notes
DateNote
2002-12-16Coordinates courtesy of Dr. Oscar M. Aparicio, University of Southern California.

Wyrick JJ, et al.  (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60
2011-02-03A single nucleotide substitution was made in the intergenic region between ARS1007 and ORF JJJ2/YJL162C.
New    113814  ATTCAAATTATTTCCATCCTGGCGTAAGGACGACGGGTATATGCTCATTAAGAAGAGCGT  113873
               |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Old    113810  ATTCAAATTATTTCCATCCTGGCGTAAGGACGGCGGGTATATGCTCATTAAGAAGAGCGT  113869
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()