YOR008W-B Feature History Help

Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide insertion was made in the intergenic region between ORFs YOR008C-A and YOR008W-B.
New    343127   GAAGTATGTAAAAAAATTACACACCATTAAGTTCTTATGTAAACCGAAGTCTGGAAGAGA  343186
                ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Old    343128   GAAGTATGTAAAAAA-TTACACACCATTAAGTTCTTATGTAAACCGAAGTCTGGAAGAGA  343186
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()