EFG1/YGR271C-A Locus History 
- Summary
- Locus History
- Literature
- Gene Ontology
- Phenotype
- Interactions
- Expression
- Protein
- Wiki
| Nomenclature History | |
|---|---|
| Standard Name | Reference |
| EFG1 | Kastenmayer JP, et al. (2006) Functional genomics of genes with small open reading frames (sORFs) in S. cerevisiae. Genome Res 16(3):365-73 |
| Sequence Annotation Notes | |
|---|---|
| Date | Note |
| 2005-11-01 | Identified based on conservation in closely related fungi. |
| Blandin G, et al. (2000) Genomic exploration of the hemiascomycetous yeasts: 4. The genome of Saccharomyces cerevisiae revisited. FEBS Lett 487(1):31-6 | |
| 2007-12-11 | Kastenmayer et al confirmed the insertion of one C nucleotide in YGR272C in an S288C strain background. As a consequence of this sequence change, YGR272C was merged into an adjacent ORF, YGR271C-A. This change extended YGR271C-A at the 5' end, increasing the size of the protein from 63 amino acids to 233 amino acids.NEW: TTCTACGCCCTTTGGGTCTGTAGATGGTGTATCATTCGGATATAGTGCAATATACTTTTC
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
OLD: 1038046 TTCTACGCC-TTTGGGTCTGTAGATGGTGTATCATTCGGATATAGTGCAATATACTTTTC 1038104
|
| Kastenmayer JP, et al. (2006) Functional genomics of genes with small open reading frames (sORFs) in S. cerevisiae. Genome Res 16(3):365-73 | |
