EFG1/YGR271C-A Locus History Help


Nomenclature History
Standard Name Reference
EFG1 Kastenmayer JP, et al.  (2006) Functional genomics of genes with small open reading frames (sORFs) in S. cerevisiae. Genome Res 16(3):365-73
Sequence Annotation Notes
DateNote
2005-11-01Identified based on conservation in closely related fungi.

Blandin G, et al.  (2000) Genomic exploration of the hemiascomycetous yeasts: 4. The genome of Saccharomyces cerevisiae revisited. FEBS Lett 487(1):31-6
2007-12-11Kastenmayer et al confirmed the insertion of one C nucleotide in YGR272C in an S288C strain background. As a consequence of this sequence change, YGR272C was merged into an adjacent ORF, YGR271C-A. This change extended YGR271C-A at the 5' end, increasing the size of the protein from 63 amino acids to 233 amino acids.

NEW:         TTCTACGCCCTTTGGGTCTGTAGATGGTGTATCATTCGGATATAGTGCAATATACTTTTC 
             ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| 
OLD: 1038046 TTCTACGCC-TTTGGGTCTGTAGATGGTGTATCATTCGGATATAGTGCAATATACTTTTC 1038104
Kastenmayer JP, et al.  (2006) Functional genomics of genes with small open reading frames (sORFs) in S. cerevisiae. Genome Res 16(3):365-73