YCL001W-B Feature History Help

Sequence Annotation Notes
DateNote
2004-04-19Based on sequence comparison to related fungi, Brachat et al. suggest that YCL001W-A and YCL001W-B be merged into a single long reading frame. This proposal was examined by SGD curators but was not incorporated at this time. The proposed merger would require multiple sequence changes, and all sequence changes must be confirmed in S288C.

Brachat S, et al.  (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
2000-09-13The systematic sequence was updated in the region between YCL001W-A and YCL001W-B. Note that coordinates listed are chromosomal coordinates.
Old:   113215 AGAAGGAGCAAATAAGCC--TTTTAAGGAACCGAGATAAGCTGTTTTCGCCCATTGTTCT 113272
              ||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||
New:   113605 AGAAGGAGCAAATAAGCCAGTTTTAAGGAACCGAGATAAGCTGTTTTCGCCCATTGTTCT 113664