SNR17B/snR17b Locus History Help


Nomenclature History
Standard Name Reference
SNR17B Hughes JM, et al.  (1987) The yeast homologue of U3 snRNA. EMBO J 6(7):2145-55
Other Name(s)Reference
U3 Hughes JM, et al.  (1987) The yeast homologue of U3 snRNA. EMBO J 6(7):2145-55
Other Notes
DateNote
2007-06-01Please note that in the UMass snoRNA database, the sequence listed for the U3b snoRNA (snR17b) differs from that listed in SGD at two nucleotides. SGD lists GG at relative position 161-162, while UMass currently lists this as TT. The UMass numbering below reflects relative coding coordinates with the intron removed; SGD numbering below reflects relative coding coordinates before the removal of the intron.
SGD:   145 taggatcatttctataggaatcgtcactctttgactcttcaaaagagccactgaatccaa 204
           ||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||
UMass: 15  taggatcatttctatattaatcgtcactctttgactcttcaaaagagccactgaatccaa 74
The SGD reference sequence is based on that received from the European yeast chromosome XVI sequencing project, based on S288C substrain AB972, as listed in GenBank records Z73499 and Z73500. The SGD sequence also matches GenBank records X96770 (Purnelle et al. 1996) and U43703 (Bussey et al. 1997), both also from strain AB972. The UMass record matches GenBank record X05498 from strain BY4743 (Hughes et al. 1987).
Bussey H, et al.  (1997) The nucleotide sequence of Saccharomyces cerevisiae chromosome XVI. Nature 387(6632 Suppl):103-5
Purnelle B, et al.  (1996) The sequence of 55 kb on the left arm of yeast chromosome XVI identifies a small nuclear RNA, a new putative protein kinase and two new putative regulators. Yeast 12(14):1483-92
Hughes JM, et al.  (1987) The yeast homologue of U3 snRNA. EMBO J 6(7):2145-55
Mapping Notes
DateNote
1998-11-10Edition 15: The annotation for this ORF has been changed. Spingola et al. ((1999) RNA 5:221-234) identified an intron that was not previously annotated and also identified a different start and stop codon.

Cherry JM, et al.  (1998) "Genetic and Physical Maps of Saccharomyces cerevisiae (Edition 15)". Pp. 414-420 in 1998 Yeast Genetics and Molecular Biology Meeting Program and Abstracts. Bethesda, MD: The Genetics Society of America
1998-11-10Edition 15: In the past, SNR17B was incorrectly associated with the ORF YPL144W, which SNR17B overlaps. SNR17B encodes the untranslated U3 small nuclear RNA gene, and YPL144W is a predicted open reading frame (ORF) for which there is presently no experimental evidence.

Cherry JM, et al.  (1998) "Genetic and Physical Maps of Saccharomyces cerevisiae (Edition 15)". Pp. 414-420 in 1998 Yeast Genetics and Molecular Biology Meeting Program and Abstracts. Bethesda, MD: The Genetics Society of America