TIM8/YJR135W-A Locus History Help


Nomenclature History
Standard Name Reference
TIM8 Koehler CM, et al.  (1999) Human deafness dystonia syndrome is a mitochondrial disease. Proc Natl Acad Sci U S A 96(5):2141-6
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide substitution was made within the intergenic region between ORFs MCM22/YJR135C and TIM8/YJR135W-A.
New    676907  ATTCATTTATATGAAAGTATTGAAGAAGAGGTAAAAAGGAAAACAAATTTACAAACAACA  676966
               ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Old    676897  ATTCATTTATATGGAAGTATTGAAGAAGAGGTAAAAAGGAAAACAAATTTACAAACAACA  676956
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()