SNR189/snR189 Locus History Help


Nomenclature History
Standard Name Reference
SNR189 SGD  (2007) Information without a citation in SGD ()
Sequence Annotation Notes
DateNote
2000-09-13The systematic sequence was updated in the region between features RPS14A/YCR031C and snR189. Note that coordinates listed are chromosomal coordinates.
Old:   176967 CTCTCCTTGGGTTTAAAATAGAATCTTCATTAAAAAAAGTGCTTTCTGTAATATATAGTG 177026	
              ||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||
New:   178235 CTCTCCTTGGGTTTAAAATAGAATCTTCATTAAAAA--GTGCTTTCTGTAATATATAGTG 178292

Old:   177087 CCAGGAAGCGGGATGGTCTGCCGCAAGCAGACAAATTTGCCAAAATGCAGTAGAGAATGG 177146
              |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   178353 CCAGGAGGCGGGATGGTCTGCCGCAAGCAGACAAATTTGCCAAAATGCAGTAGAGAATGG 178412

Old:   177147 CAATGCTCGTGCTGAAGGTTAAAAAAAGAACGCAAAAAAAAAAAGAGTAGTAAAATGTAC 177206
              ||||||||||||||||||| ||||||||||||||||||||||  ||||||||||||||||
New:   178413 CAATGCTCGTGCTGAAGGTGAAAAAAAGAACGCAAAAAAAAA--GAGTAGTAAAATGTAC 178470
2000-09-13The systematic sequence was updated within feature snR189. Note that coordinates listed are chromosomal coordinates.
Old:   177327 ATGAATAGAGATGTCAGGCCCGTGTGAAGTACTTGAAAGTAATAAGTGAGTATATAGAAT 177386
              | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   178591 AAGAATAGAGATGTCAGGCCCGTGTGAAGTACTTGAAAGTAATAAGTGAGTATATAGAAT 178650
2000-09-13The systematic sequence was updated in the region between features snR189 and BPH1/YCR032W. Note that coordinates listed are chromosomal coordinates.
Old:   177747 CGTTGCAAAGCTTTGTTTGCGGTATGTTAATAAAGTTACCATGAAGCTTTTTTCATGCTC 177806
              |||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||
New:   179011 CGTTGCAAAGCTTTGTTTGCGGTATGTTAATAAAGTTACCATGAAGCTTTTTTACTGCTC 179070

Old:   178227 AAAAAAAAAACACAATACGGATATGAATTCAATTATTAATGCTGCTTCGAAAGTCTTAAG 178286
              ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
New:   179491 AAAAAAAAA-CACAATACGGATATGAATTCAATTATTAATGCTGCTTCGAAAGTCTTAAG 179549