SNR33/snR33 Locus History Help


Nomenclature History
Standard Name Reference
SNR33 SGD  (2007) Information without a citation in SGD ()
Sequence Annotation Notes
DateNote
2000-09-13The systematic sequence was updated in the region upstream of feature snR33. Note that coordinates listed are chromosomal coordinates.
Old:   142151 TTTTAATTCTTATGAAAAAAAAA-TGTGGAAGAGAGCAGAAAATTTTCATAATGAATCTC 142209
              ||| ||||||||||||||||||| |||| ||||||| ||||||||||||||| |||||||
New:   142546 TTT-AATTCTTATGAAAAAAAAAATGTGAAAGAGAGTAGAAAATTTTCATAACGAATCTC 142604
Old:   142270 AAAAAAAAAAACTAGTATATAAAGTAAAAAAAGATGCGCAAGCCCGGAATCGAACCGGGG 142329
              |||||||||   ||||||||||||||||||| ||||||||||||||||||||||||||||
New:   142665 AAAAAAAAA---TAGTATATAAAGTAAAAAA-GATGCGCAAGCCCGGAATCGAACCGGGG 142720
Old:   142330 GCCCAACGATGGCAACGTTGGATTTTACCACTAAACCACTTGCGCTAGTAATATTGATGC 142389
              |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
New:   142721 GCCCAACGATGGCAACGTTGGATTTTACCACTAAACCACTTGCGCTAGTAATCTTGATAC 142780
Old:   142390 ATTATTCAAGAAAAGCAAAAAACATATTAGCCGATAATTTCTATTTTATAAGTAAAAA 142447
              |||||||
New:   142781 ATGATTC--------------------------------------------------- 142787
Old:   142448 CATTGGTGAGATAGTGGTAAAGAGTTAGATAATTATTGGGATTCCATTGTTGAGAAAAGCAATAATATTATGTA 142521
                                                                 |||||||||||||||||||||||
New:   142787 ---------------------------------------------------GAGAAAAGCAACAATATTATGTA 142810
2000-09-13The systematic sequence was updated within feature snR33. Note that coordinates listed are chromosomal coordinates.
Old:   142091 AAATTACCTAAATAATTTTAGAGTGACACCATCGTACAAAGAGGGCATTAAGCTTATTTT 142150
              ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   142486 AAATTACGTAAATAATTTTAGAGTGACACCATCGTACAAAGAGGGCATTAAGCTTATTTT 142545
Other Notes
DateNote
2007-06-07Please note that in the UMass snoRNA database, the sequence listed for the SNR33 snoRNA differs from that listed in SGD at one nucleotide. SGD lists a G at chromosomal coordinate 142497, while UMass currently lists this nucleotide as a C; note that SNR33 is encoded on the Crick strand. The UMass numbering below reflects relative coding coordinates; SGD numbering below reflects chromosomal coordinates.
UMass: 183    GATTGTCCACACACTTCTATATCAATTCCAACTAAGAAAACGAAGGAACCGACTCAAACC 124
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
SGD:   142362 GATTGTCCACACACTTCTATATCAATTCCAACTAAGAAAACGAAGGAACCGACTCAAACC 142421

UMass: 123    GGTGTAAAAGCTAGGCTTTCAATCTCTGCTCCTCCAAACAAAACTAGTGCTTGATATCAC 64
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
SGD:   142422 GGTGTAAAAGCTAGGCTTTCAATCTCTGCTCCTCCAAACAAAACTAGTGCTTGATATCAC 142481

UMass: 63     ATCCAATTAAATTACCTAAATAATTTTAGAGTGACACCATCGTACAAAGAGGGCATTAAG 4
              ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| 
SGD:   142482 ATCCAATTAAATTACGTAAATAATTTTAGAGTGACACCATCGTACAAAGAGGGCATTAAG 142541

UMass: 3      CTT 1
              ||| 
SGD:   142542 CTT 142544
The SGD reference sequence is based on that received from the European Yeast Chromosome III Sequencing Project, based on S288C substrains XJ24-24a, AB972, A364A, and DC5, as listed in GenBank record X59720. The UMass sequence matches GenBank record L22435 from strains BJ2407 and GRF167, as described in Balakin et al. 1993.
Balakin AG, et al.  (1993) SnR31, snR32, and snR33: three novel, non-essential snRNAs from Saccharomyces cerevisiae. Nucleic Acids Res 21(23):5391-7
Samarsky DA and Fournier MJ  (1999) A comprehensive database for the small nucleolar RNAs from Saccharomyces cerevisiae. Nucleic Acids Res 27(1):161-4