YMRWdelta20 Feature History Help

Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide substitution was made in the intergenic region between LTRs YMRCtau3 and YMRWdelta20.
New    808920  TGATTTGCGCAACGCAGATACAGATTTTACTTTATTCTTCGTGCCTAAAATGGACCATCGTTTCACTTAC  808989
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Old    808919  TGATTTGCGCAACGCAGATACAGATTTTACTTTATTCTTCGTGCCTAAAATGGACCAACGTTTCACTTAC  808988
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()