YKRCdelta8 Feature History Help

Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide substitution was made in the intergenic region between ORF FOX2/YKR009C and Ty1 LTR YKRCdelta8.
New    458084  CTCTTCATACATATAAATGTTGCAATAAAAATCAACTAATATCTATGTTGTCATATTGAG  458143
               |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Old    457727  CTCTTCATACATATAAATGTTGCAATAAAAATCAACTAATATCTATGTCGTCATATTGAG  457786
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()