YJLWTy4-1 Feature History Help


Nomenclature History
Other Name(s)Reference
Ty4 Kim JM, et al.  (1998) Transposable elements and genome organization: a comprehensive survey of retrotransposons revealed by the complete Saccharomyces cerevisiae genome sequence. Genome Res 8(5):464-78
Sequence Annotation Notes
DateNote
2002-11-19The YJLWdelta2 element was initially mistakenly annotated as a separate LTR, though its coordinates completely overlapped with the full length transposon YJLWTy4-1. Thus, YJLWdelta2 has been deleted from the database.
2011-02-03Two separate single nucleotide deletions were made within retrotransposon YJLWTy4-1, affecting Gag and Pol ORFs YJL114W and YJL113W.
New    198581  AAAAACAAA-TATAGAAGTTTGCATGGTAGAGATGTCAGAATTAGAGCCTGGG-AAAAGG  198639
               ||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||
Old    198579  AAAAACAAAATATAGAAGTTTGCATGGTAGAGATGTCAGAATTAGAGCCTGGGGAAAAGG  198638
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()