YIRCdelta6 Feature History Help

Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide was inserted in the intergenic region between YIRCdelta6 and YPS6/YIR039C.
New  427139  GGAAAAACGGCAACAGTATTTGTAAGCGCTTTCCAGTAAAATAACGAAAAAGAGAAAACTTCAGTACCAC  427208
             |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Old  427136  GGAAAAACGGCAACAGTATTTGTAAGCGCTTTCCAGTAAAATAACGAAAAAGAG-AAACTTCAGTACCAC  427204
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()