YCLWTy5-1 Feature History Help


Nomenclature History
Other Name(s)Reference
Ty5 Kim JM, et al.  (1998) Transposable elements and genome organization: a comprehensive survey of retrotransposons revealed by the complete Saccharomyces cerevisiae genome sequence. Genome Res 8(5):464-78
Sequence Annotation Notes
DateNote
2000-09-13A single nucleotide insertion was made in the systematic sequence in the region encompassing overlapping features ARS300, YCLWTy5-1, and YCL076W. A single C was inserted after the T at 1435. This change resulted in the predicted protein encoded by YCL076W being elongated at the N-terminal end by 51 amino acids. Note that coordinates listed are chromosomal coordinates.
Old:    1434 CT-AGAGCAATGCTTCTGAGAACATAATCAATCTATCTAGCCCCAACAATTATAAACAGT 1492
             || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:    1441 CTCAGAGCAATGCTTCTGAGAACATAATCAATCTATCTAGCCCCAACAATTATAAACAGT 1500