YCLWdelta5 Feature History Help

Sequence Annotation Notes
DateNote
2000-09-13A sequence change was made in the systematic sequence in the region encompassing feature YCLWdelta5. Note that coordinates listed are chromosomal coordinates.
Old:   90732 GTGAGAGCCGCGGAACCGGCTTTTCATATAGAATAGAGAAGCGTTCATGACTAAATGCTT 90791
             ||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||
New:   91116 GTGAGAGCGCCGGAACCGGCTTTTCATATAGAATAGAGAAGCGTTCATGACTAAATGCTT 91175