YCLWdelta2a Feature History Help

Sequence Annotation Notes
DateNote
2000-09-13One sequence change was made in the systematic sequence in the region encompassing feature YCLWdelta2a. Note that coordinates listed are chromosomal coordinates.
Old:   84074 TATAAAATGATGATAATAATATTTATAGAATTGTGTAGAATTGCAGATTCCCTTTTATGG 84133
             |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
New:   84460 TATAAAATGATGATAATAATATTTATAGAATTGTATAGAATTGCAGATTCCCTTTTATGG 84519