YCLCdelta1 Feature History Help

Sequence Annotation Notes
DateNote
2007-04-02The following LTRs on Chromosome III were mistakenly annotated in the wrong direction (i.e., on the Watson strand instead of Crick), and the error has now been corrected: YCLCdelta1, YCRCdelta6, YCRCdelta7, YCRCdelta14. Thanks go to Marc Gartenberg for bringing this annotation error to our attention.
2000-09-13Several sequence changes were made in the systematic sequence in the region downstream of YCLCdelta1. Note that coordinates listed are chromosomal coordinates.
Old:   83242 GGTTCTAACCGATGCCGAAGAACTGCGCGATCCGGTTATAACGTCTGACATGTCCTTTTT 83301
             ||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||
New:   83621 GGTTCTAACCGATGCCGAAGAACTGCGCAGTCCGGTTATAACGTCTGACATGTCCTTTTT 83680
Old:   83302 TGATTTGGAATCCAACCACTCA-GTGACTCTGT-CATT-ACTT-GCGAAAT-TATTCC-A 83355
             |||||||||||||||||||||| |||||||||| |||| |||| ||||||  ||| || |
New:   83681 TGATTTGGAATCCAACCACTCAAGTGACTCTGTTCATTTACTTTGCGAAAAATATACCCA 83740
Old:   83356 CAAATT--CCATCGAAAGTGAATCGCAAACCACCTTCAGACTGGCACCGACAAAGCAAAG 83413
             ||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   83741 CAAATTGCCCATCGAAAGTGAATCGCAAACCACCTTCAGACTGGCACCGACAAAGCAAAG 83800
Old:   83954 CCTAGTATATTATCATATACGGTGTTAGAAGATGACGCAAATGATGAGAAATAGTCATCT 84013
             | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   84341 C-TAGTATATTATCATATACGGTGTTAGAAGATGACGCAAATGATGAGAAATAGTCATCT 84399
2000-09-13A large insertion was made in the systematic sequence in the intergenic region between tRNA-Glu and YCLCdelta1. The following sequence was inserted after the TAAAATATTTCCTCTTTAGTACT ending at 82662:
GTTGGAATAGAAATCAACTATCATCTACTAACTAGTATTTACATTACTAG
TATATTATCATATACGGTGTTAGAAGATGACGCAAATGATGAGAAATAGT
CATCTAAATTAGTGGAAGCTGAAACGCAAGGATTGATAATGTAATAGGAT
CAATGAATATAAACATATAAAACGGAATGAGGAATAATCGTAATATTAGT
ATGTAGAAATATAGATTCCATTTTGAGGATTCCTATATCCTCGAGGAGAA
CTTCTAGTATATTCTGTATACCTAATATTATAGCCTTTATCAACAATGGA
ATCCCAACAATTATCTCAACATTCACCCATTTCTCAAGTACT