YBRCdelta14 Feature History Help

Sequence Annotation Notes
DateNote
2007-04-05The following Ty1 LTRs on Chromosome II were mistakenly annotated on the wrong strand (i.e., on Watson instead of Crick); the error has now been corrected, so that the LTRs are annotated on the Crick strand: YBLCdelta7, YBRCdelta11, YBRCdelta14, YBRCdelta19.
2011-02-03Several nucleotide changes were made within the intergenic region between ORF YBR013C and Ty1 LTR YBRCdelta14.
New    265852  GATACATATCCTGAATAAGGGATATATCATTATGAGGTTAAGTGGCCTAAAA-ACGCAAT  265910
               |||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||
Old    265850  GATACATATCCTGAATAAGGGATATATCATTATGAGGTTAAGTGGCCTAAAACACTCAAT  265909
New    265911  TAATACGGATCC-TTGTACTATTAAGTCTTTTCTATCTCTGAAAATTAACTTAAGAAGCG  265969
               |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Old    265910  TAATACGGATCCCTTGTACTATTAAGTCTTTTCTATCTCTGAAAATTAACTTAAGAAGCG  265969
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()