tV(AAC)G1 Feature History Help

Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide insertion was made in the intergenic region between tRNA-Val tV(AAC)G1 and Ty1 LTR YGLWdelta10.
New    412357   ACCACGAAACCAGTTTTTTGATGTTTCGTTTAGGGACAAGAGTCCTATGAGAGTCCACTA  412416
                |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Old    412360   ACCACGAAACCAGTTTTTTGATGTTTCGTTTAGG-ACAAGAGTCCTATGAGAGTCCACTA  412418
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()