tQ(UUG)C Feature History Help

Sequence Annotation Notes
DateNote
2000-09-13The systematic sequence was updated in the region encompassing feature tQ(UUG)C. Note that coordinates listed are chromosomal coordinates.
Old:   168303 TGCTACTAGCATTTTATCACATGAGGTGAGGTGTAAGAAGATGACATAAAGATTGAGATA 168362
              ||||||||||||||||||||||||||||     |||||||||||||||||||||||||||
New:   169609 TGCTACTAGCATTTTATCACATGAGGTG-----TAAGAAGATGACATAAAGATTGAGATA 169663
2000-09-13The systematic sequence was updated in the region encompassing features tQ(UUG)C and YCRWdelta11. Note that coordinates listed are chromosomal coordinates.
Old:   168363 CAGTCCTCAAACCTAATGGAAGCGAAATGCAGGGATTGATAATGTAATAAGATAATGAAA 168422
              ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   169664 CAGTCATCAAACCTAATGGAAGCGAAATGCAGGGATTGATAATGTAATAAGATAATGAAA 169723
Old:   168423 CATAAGAAACAGAAGGTAGTAGTATTATTATGTAGAAATACCCATTCCATTTTAAGGATT 168482
              ||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||
New:   169724 CATAAGAAACAGAAGGTAGGAGTATTATTATGTAGAAATACCGATTCCATTTTAAGGATT 169783
Old:   168483 CCTATGTCCTCGAGTAGAACGTCTAGTATATACGAAATATTATACCCTTTAAAAAACACT 168542
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
New:   169784 CCTATGTCCTCGAGTAGAACGTCTAGTATATACGAAATATTATACCCTTTAAAAAACAGT 169843
Old:   168663 CTGATCTCCCAATGAAGAATTGTGTCAGGTCATCTCGTCCTCAATTTCTAACCAAAATTG 168722
              ||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||
New:   169964 CTGATCTCCCAATGAAGAACTGCGTCAGGTCATCTCGTCCTCAATTTCTAACCAAAATTG 170023
Old:   168783 CACAACACGGTAAACCAACTTGTGTCATATTTAAGAGAAATATTAAAACGCTAAGAAGAT 168842
              |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   170084 CACAGCACGGTAAACCAACTTGTGTCATATTTAAGAGAAATATTAAAACGCTAAGAAGAT 170143
Old:   168843 AGCTCCCATAATAGAAGTACAAGTTATATTTATCGTTGCCCAACTGCAGAAGTTAAATAA 168902
              |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
New:   170144 AGCTCCCATAATAGAAGTACAAGTTATATTTATCGTTGTCCAACTGCAGAAGTTAAATAA 170203
2000-09-13The systematic sequence was updated in the region encompassing features tQ(UUG)C and YCRWdelta11. Note that coordinates listed are chromosomal coordinates.
Old:   168903 AGGTAAATAAATCGAGCTAAGAGAAAAAAAA-GTATAGGCAAAATTCCGACCGGAGCTAG 168961
              ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
New:   170204 AGGTAAATAAATCGAGCTAAGAGAAAAAAAAAGTATAGGCAAAATTCCGACCGGAGCTAG 170263
Old:   168962 CTTTACCTTGCTCCTCCACCTAAGTCACCTGCTCAGGTCACTCAAGTTCACAATCTTCTG 169021
              ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   170264 CTTTATCTTGCTCCTCCACCTAAGTCACCTGCTCAGGTCACTCAAGTTCACAATCTTCTG 170323
Old:   169022 AGAGGATAGATAAAGGAAAAATTGGAACAGATCTTTTCATGGCCTGGCAGTTGTCTGTGG 169081
              ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
New:   170324 AGAGGATAGATAAAGGAAAAATTGGAACAGATCTTTTCATGGCCTGGCAATTGTCTGTGG 170383
Old:   169082 ATTGGTAAAGCTCTGTCAGTGAAAAAAAA-GTTCTCGCTCCTTCTTGGTCTCTTCTATTT 169140
              ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
New:   170384 ATTGGTAAAGCTCTGTCAGTGAAAAAAAAAGTTCTCGCTCCTTCTTGGTCTCTTCTATTG 170443
Old:   169201 ATAATCTTGAAATTTGAAGTTTCTAAAATGCATCAGACATGGTGTCGTAGTTAGTTGATT 169260
              ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
New:   170504 ATAATCTTGAAATTTGAAGTTTCTAAAATGCATCAGACATGGTGTCGTAATTAGTTGACT 170563
Old:   169321 AAAATACTTACTAAACGTTTTCGAATAAGTTAGCAAGAAGCTTTTAAAAACATAGACTTA 169380
              |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
New:   170624 AAAATACTTACTAAACCTTTTCGAATAAGTTAGCAAGAAGCTTTTAAAAACATAGACTTA 170683
Old:   169441 TGCATGATGAAAAGCTAAGTAGACCTCTTTAGAAGTGTCTTAGCGGCTATTGTTCATGAT 169500
              ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
New:   170744 TGCATGATGAAAAACTAAGTAGACCTCTTTAGAAGTGTCTTAGCGGCTATTGTTCATGAT 170803