tK(CUU)F Feature History Help

Sequence Annotation Notes
DateNote
2011-02-03A single C nucleotide was inserted near the 3' end of tK(CUU)F, altering the coding sequence and making this tRNA one nucleotide longer.
Old: 46 GTTAGGGGTTCGAGCCCC-TACAGGGCT 72
        |||||||||||||||||| ||||||||| 
New: 46 GTTAGGGGTTCGAGCCCCCTACAGGGCT 73
   
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
2011-02-03A single nucleotide insertion was made in the intergenic region between ORF YFR035C and tRNA tK(CUU)F.
New    226679  AAAGAGATAAGCCCTGTAGGGGGCTCGAACCCCTAACCTTATGATTAAGAGTCATACGCG  226738
               |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Old    226667  AAAGAGATAAGCCCTGTA-GGGGCTCGAACCCCTAACCTTATGATTAAGAGTCATACGCG  226725
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()