tH(GUG)H Feature History Help

Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide substitution was made in the intergenic region between ORF NPR3/YHL023C and tRNA tH(GUG)H.
New    62640   CTATGTTTAATGGTATTTCAAGATATCACAAGCGAAAAAGTTACTTAAGAAAAAAGACTA  62699
               ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Old    62638   CTATGTTTAATGGTATTTCAAGATATCACAAGCGAAAAAGTTACTTAAGGAAAAAGACTA  62697
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()