tH(GUG)E2 Feature History Help

Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide substitution was made in the intergenic region between GLC7/YER133W and tH(GUG)E2.
New    434281  CAATTTTTCTTTATTTTCTTTTATTACTATTATCATTACTATTATTATTAGTATTATTAT  434340
               ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    434277  CAATTTTCCTTTATTTTCTTTTATTACTATTATCATTACTATTATTATTAGTATTATTAT  434336
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()