SUF16/tG(GCC)C Locus History Help


Nomenclature History
Standard Name Reference
SUF16 Gaber RF and Culbertson MR  (1982) Frameshift suppression in Saccharomyces cerevisiae. IV. New suppressors among spontaneous co-revertants of the Group II his4-206 and leu 2-3 frameshift mutations. Genetics 101(3-4):345-67
Sequence Annotation Notes
DateNote
2000-09-13The systematic sequence was updated in the intergenic region between features tG(GCC)C and YCR016W. Note that coordinates listed are chromosomal coordinates.
Old:   143002 GCAAACGCTTTTGTTATTGAGAACAGGAATACCAACCGTTCTCATGGAAAATAGCAAAGT 143061
              ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
New:   143291 GCAAACGCTTTTGTTATTGGGAACAGGAATACCAACCGTTCTCATGGAAAATAGCAAAGT 143350
Old:   143242 GAAAAGAGATGAGCTAAATTCAAATATCAAAGTACTGTGGTAAGTGCTTTCTTTATCGAC 143301
              ||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||
New:   143531 GAAAAGAGATGAGCTAAATTCAAATATCAAAGTACTGTCATAAGTGCTTTCTTTATCGAC 143590
Old:   143302 AAATTACAAGCAGAAGAAACATTCACTTTACAATTAAATGTCCGAAAATCACGTTCCTGC 143361
              |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
New:   143591 AAATTACAAGCAGAAGAAACATTCACTTCACAATTAAATGTCCGAAAATCACGTTCCTGC 143650