tF(GAA)N Feature History Help

Sequence Annotation Notes
DateNote
2011-02-03Three separate single nucleotide substitutions were made in the intergenic region between ORF FYV6/YNL133C and tRNA tF(GAA)N.
New    374698  TATAACAGAGCCCACAGTCTTTTGTTGGAACCGCTTTCTCTAGGCTTCGATGGACTTACA  374757
               |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Old    374700  TATAACAGAGCCCACAGTCTTTTGTTGGAACCGCTTTCTCTAGGTTTCGATGGACTTACA  374759
New    374758  TCTAATTGCACATTCTCGTGCGTTTAAACGTCATTTTTCCCTCAGATTGGCAGTGCATCA  374817
               |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||
Old    374760  TCTAATTGAACATTCTCGTGCGTTTAAACGTCATTTTTCCCTCAGATTGGAAGTGCATCA  374819
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()