tF(GAA)B Feature History Help

Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide substitution was made in the intergenic region between Ty4 LTR YBLCtau1 and tRNA-Phe tF(GAA)B.
New    36299   TGTGCTTCAGTATTACATTTTTTGCCTTCAACGCCTTGATTGTTCTATTTTTGCTAATAA  36358
               |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Old    36296   TGTGCTTCAGTATTACTTTTTTTGCCTTCAACGCCTTGATTGTTCTATTTTTGCTAATAA  36355
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
2011-02-03A single nucleotide substitution was made in the intergenic region between tRNA-Phe tF(GAA)B and ORF ATP1/YBL099W.
New    36659   ATTTATTGTAATTATTATACATTGGTCATATCAAATTCACATCAGACTTCAATTTTTCAA  36718
               ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Old    36656   ATTTATTGTAATTATTAAACATTGGTCATATCAAATTCACATCAGACTTCAATTTTTCAA  36715
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()