SNR48/snR48 Locus History Help


Nomenclature History
Standard Name Reference
SNR48 Lowe TM and Eddy SR  (1999) A computational screen for methylation guide snoRNAs in yeast. Science 283(5405):1168-71 Balakin, A.G. et al.  (1998) Initial identification as C/D box snoRNA. Unpublished
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide substitution was made in the intergenic region between snoRNA SNR48 and ORF ERG25/YGR060W.
New    610052   ACGGCCACTGCCACTACCACTGCCTCCCTTCGTATACGGGACACAGAGATCGTATACGGT  610111
                ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Old    610056   ACGGCCACTGCCACTACCACTGCCTCCCTTCGTATACGGAACACAGAGATCGTATACGGT  610115
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()