RPL22B/YFL034C-A Locus History 
- Summary
- Locus History
- Literature
- Gene Ontology
- Phenotype
- Interactions
- Expression
- Protein
- Wiki
| Nomenclature History | |
|---|---|
| Standard Name | Reference |
| RPL22B | SGD (2007) Information without a citation in SGD () |
| Other Name(s) | Reference |
|---|---|
| l1c | Planta RJ and Mager WH (1998) The list of cytoplasmic ribosomal proteins of Saccharomyces cerevisiae. Yeast 14(5):471-7 |
| L22B | Planta RJ and Mager WH (1998) The list of cytoplasmic ribosomal proteins of Saccharomyces cerevisiae. Yeast 14(5):471-7 |
| L22e | Jenner L, et al. (2012) Crystal structure of the 80S yeast ribosome. Curr Opin Struct Biol 22(6):759-67 |
| rp4 | Planta RJ and Mager WH (1998) The list of cytoplasmic ribosomal proteins of Saccharomyces cerevisiae. Yeast 14(5):471-7 |
| YL31 | Planta RJ and Mager WH (1998) The list of cytoplasmic ribosomal proteins of Saccharomyces cerevisiae. Yeast 14(5):471-7 |
| Nomenclature History Notes | |
|---|---|
| Date | Note |
| 2000-08-11 | Old name: YFL035C-B; new name: YFL034C-A; date: 11/1998; old coord: ChrVI 64932 64243; SGDID: S0002967; Name changed due to nomenclature |
| 2003-12-09 | Due to a nomenclature change, the name YFL035C-B was changed to YFL034C-A. |
| Sequence Annotation Notes | |
|---|---|
| Date | Note |
| 2011-02-03 | A single nucleotide insertion was made in the intergenic region between ORFs RPL22B/YFL034C-A and YFL034W.
New 65101 GCTCGCGTTGTCTAAAAAAAAAAGTTTGGAAACTTTTTTGTATAATTTATGGGTGTTATC 65160
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Old 65100 GCTCGCGTTGTCT-AAAAAAAAAGTTTGGAAACTTTTTTGTATAATTTATGGGTGTTATC 65158 |
| Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. () | |
