THI22/YPR121W Locus History Help


Nomenclature History
An SGD Standard Name was first assigned to this gene on 2000-12-12.
Standard Name Reference
THI22 Llorente B, et al.  (1999) Genetic redundancy and gene fusion in the genome of the Baker's yeast Saccharomyces cerevisiae: functional characterization of a three-member gene family involved in the thiamine biosynthetic pathway. Mol Microbiol 32(6):1140-52
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide substitution within the coding region of THI22/YPR121W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 95 is now Glutamine rather than Histidine.
New    778858  CGGCGCTCAAAATATACCAAAGAAAATGGTATCTCAAATATTAGACGCCAATTTACAGGA  778917
               ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Old    778854  CGGCGCTCATAATATACCAAAGAAAATGGTATCTCAAATATTAGACGCCAATTTACAGGA  778913
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
2011-02-03Two single nucleotide insertions were made in the intergenic region between YPRWdelta16 and YPR121W/THI22.
New    778258  TTAATGGAATAACGTGATTTTTGTACCAAATTGCCTATTTCAGATTCGGCGTGCGCTTCC  778317
               ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Old    778256  TTAATGGAATAACGTGATTTTTGTACCAAATTGCCTATTTCAGATTC-GCGTGCGCTTCC  778314
New    778368  TGCACGGAAGATCCTTGCAGGAATCAAATACTGCCTTTCACTTTGCAACCTCTTAATCACATAGTAGCAC  778437
               |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    778365  TGCACGGAAGAT-CTTGCAGGAATCAAATACTGCCTTTCACTTTGCAACCTCTTAATCACATAGTAGCAC  778433
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()