GLN1/YPR035W Locus History Help


Nomenclature History
Standard Name Reference
GLN1 SGD  (2007) Information without a citation in SGD ()
Sequence Annotation Notes
DateNote
2011-02-03Nucleotide change(s) in the coding region of GLN1/YPR035W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 251 is now Threonine rather than Alanine, and residue 264 is now Methionine rather than Threonine.
New  642949 GGTTGTCACACTAACGTTTCCACCAAGGAAATGAGACAACCAGGTGGTATGAAATACATCGAACAAGCCA 643018
            ||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Old  642946 GGTTGTCACGCTAACGTTTCCACCAAGGAAATGAGACAACCAGGTGGTACGAAATACATCGAACAAGCCA 643015
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
2011-02-03A single nucleotide substitution was made in the intergenic region between ORFs YPR035W/GLN1 and YPR036W/VMA13.
New    643559  TCGAATTTTTTCTTTTTTTTTTTCTGCAAAGCGACGCTGTGTTGTATATTGCTCTAAAAT  643618
               ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Old    643556  TCGAATTTTTTCTTTTTTTTTTTTTGCAAAGCGACGCTGTGTTGTATATTGCTCTAAAAT  643615
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()