MSC6/YOR354C Locus History Help


Nomenclature History
Standard Name Reference
MSC6 Thompson DA and Stahl FW  (1999) Genetic control of recombination partner preference in yeast meiosis. Isolation and characterization of mutants elevated for meiotic unequal sister-chromatid recombination. Genetics 153(2):621-41
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide deletion was made in the intergenic region between ORFs MSC6/YOR354C and GDS1/YOR355W.
New    1004693  TCAGCATTCCATTATTGAAGGCTTTAAAATAATAGTTTCTTTTTTCC-TATTATTTTATT  1004751
                ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Old    1004690  TCAGCATTCCATTATTGAAGGCTTTAAAATAATAGTTTCTTTTTTCCTTATTATTTTATT  1004749
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()