TIM18/YOR297C Locus History Help


Nomenclature History
An SGD Standard Name was first assigned to this gene on 2001-10-04.
Standard Name Reference
TIM18 Kerscher O, et al.  (2000) Tim18p is a new component of the Tim54p-Tim22p translocon in the mitochondrial inner membrane. Mol Biol Cell 11(1):103-16 Koehler CM, et al.  (2000) Tim18p, a new subunit of the TIM22 complex that mediates insertion of imported proteins into the yeast mitochondrial inner membrane. Mol Cell Biol 20(4):1187-93
Sequence Annotation Notes
DateNote
2011-02-03Nucleotide change(s) in the coding region of TIM18/YOR297C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 137 is now Glutamic Acid rather than Glycine.
New    874863   TCCTCCATAGAGGCAATAAAGGGCGAGCTTATGCCATCTTGGATACTTTTCCTTCGGTAT  874922
                ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Old    874862   TCCTCCATAGAGGCAATAAAGGGCGAGCTTATGCCATCTTGGATACTTTCCCTTCGGTAT  874921
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()