SFL1/YOR140W Locus History Help


Nomenclature History
Standard Name Reference
SFL1 Fujita A, et al.  (1989) Domains of the SFL1 protein of yeasts are homologous to Myc oncoproteins or yeast heat-shock transcription factor. Gene 85(2):321-8
Sequence Annotation Notes
DateNote
2011-02-03Nucleotide change(s) in the coding region of SFL1/YOR140W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 446-462 are now FVQYQPQSQQHVTYAKQ rather than LYNTNRSRNQHVTYASE.
New    588314   TTTTTGTACAATACCAACCGCAGTCGCAAC-AACATGTGACTTATGCGAAGCAACCGGCA  588372
                |||| ||||||||||||||||||||||||| ||||||||||||||||||   ||||||||
Old    588315   TTTT-GTACAATACCAACCGCAGTCGCAACCAACATGTGACTTATGCGAGCGAACCGGCA  588373
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()