VPS5/YOR069W Locus History Help


Nomenclature History
Standard Name Reference
VPS5 Robinson JS, et al.  (1988) Protein sorting in Saccharomyces cerevisiae: isolation of mutants defective in the delivery and processing of multiple vacuolar hydrolases. Mol Cell Biol 8(11):4936-48 Rothman JH, et al.  (1989) Characterization of genes required for protein sorting and vacuolar function in the yeast Saccharomyces cerevisiae. EMBO J 8(7):2057-65
Other Name(s)Reference
VPT5 Bankaitis VA, et al.  (1986) Isolation of yeast mutants defective in protein targeting to the vacuole. Proc Natl Acad Sci U S A 83(23):9075-9
Nomenclature History Notes
DateNote
2009-04-21The VPL5 name was originally associated with VPS5/YOR069W. However, further complementation analysis indicated that the vpl5 mutant is actually allelic to SNF7/YLR025W, also known as VPS32.

Robinson JS, et al.  (1988) Protein sorting in Saccharomyces cerevisiae: isolation of mutants defective in the delivery and processing of multiple vacuolar hydrolases. Mol Cell Biol 8(11):4936-48
Rothman JH, et al.  (1989) Characterization of genes required for protein sorting and vacuolar function in the yeast Saccharomyces cerevisiae. EMBO J 8(7):2057-65
Raymond CK, et al.  (1992) Morphological classification of the yeast vacuolar protein sorting mutants: evidence for a prevacuolar compartment in class E vps mutants. Mol Biol Cell 3(12):1389-402
Sequence Annotation Notes
DateNote
2004-04-21Based on the automated comparison of related fungi, Cliften et al. and Brachat et al. suggest that the start site for VPS5/YOR069W be moved 1089 nt upstream, extending the 5' end of the protein an additional 363 amino acids. This suggestion was reviewed and accepted by SGD curators. Evidence supporting this change includes: (1) this is the predicted start methionine in all Saccharomyces species sequenced by Cliften et al. and/or Kellis et al. and (2) this is the start site described in literature characterizing VPS5/YOR069W (Horazdovsky BF, et al.,(1997) Mol Biol Cell. Aug; 8(8):1529-41),(Nothwehr ST, Hindes AE (1997) J Cell Sci. May;110 (Pt 9):1063-72.).

Kellis M, et al.  (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
Brachat S, et al.  (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
Cliften P, et al.  (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2001-05-31Inserted one G nucleotide after the G at chromosomal coordinate 453805, in the intergenic region to the left of overlapping ORFs YOR068C and YOR068W:
Old: 453752 ATCCTGCAATAACAAGCCATGGACTACGAGGATAATCTAGAAGCACCTGTTTGG-ACGAA 453810
            |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
New: 453752 ATCCTGCAATAACAAGCCATGGACTACGAGGATAATCTAGAAGCACCTGTTTGGGACGAA 453811
Other Notes
DateNote
2005-01-06Although VAM10/YOR068C overlaps completely with VPS5/YOR069W, it has been demonstarted that these are two distinct, verified ORFs.

Kato M and Wickner W  (2003) Vam10p defines a Sec18p-independent step of priming that allows yeast vacuole tethering. Proc Natl Acad Sci U S A 100(11):6398-403