YOR050C Feature History Help

Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide deletion was made in the intergenic region between ORFs RSB1/YOR049C and YOR050C.
New    423716   CGAAGGTTCGGTACCATACCACCATAAAGGGAATT-ACTGTTAGCTGCTGCTTCTAACTG  423774
                ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Old    423717   CGAAGGTTCGGTACCATACCACCATAAAGGGAATTTACTGTTAGCTGCTGCTTCTAACTG  423776
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()