RRP40/YOL142W Locus History Help


Nomenclature History
An SGD Standard Name was first assigned to this gene on 2001-10-08.
Standard Name Reference
RRP40 Allmang C, et al.  (1999) The yeast exosome and human PM-Scl are related complexes of 3' --> 5' exonucleases. Genes Dev 13(16):2148-58
Other Name(s)Reference
MTR14 Smith SB, et al.  (2011) Pronounced and extensive microtubule defects in a Saccharomyces cerevisiae DIS3 mutant. Yeast 28(11):755-69
Sequence Annotation Notes
DateNote
2011-02-03Nucleotide change(s) in the coding region of RRP40/YOL142W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 160 is now Leucine rather than Phenylalanine.
New    55991    CTGGTTTCGGGATATTGGAAGATGGTATGATCATTGACGTGAATTTGAATTTCGCACGCC  56050
                |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Old    55990    CTGGTTTCGGGATATTGGAAGATGGTATGATCATTGACGTGAATTTCAATTTCGCACGCC  56049
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
Mapping Notes
DateNote
1998-11-10Edition 15: Component of the exosome complex of 3'->5' exonucleases. Homologous to 3'->5' exonuclease Rrp4p

Cherry JM, et al.  (1998) "Genetic and Physical Maps of Saccharomyces cerevisiae (Edition 15)". Pp. 414-420 in 1998 Yeast Genetics and Molecular Biology Meeting Program and Abstracts. Bethesda, MD: The Genetics Society of America