MED7/YOL135C Locus History Help


Nomenclature History
Standard Name Reference
MED7 Myers LC, et al.  (1998) The Med proteins of yeast and their function through the RNA polymerase II carboxy-terminal domain. Genes Dev 12(1):45-54
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide substitution was made in the intergenic region between ORFs PFK27/YOL136C and MED7/YOL135C.
New    69060    AACCGAGTAATCCAATTTACTTTTTCTACTTTTTTTTCATTATCAATCGATTCAGATGCC  69119
                |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Old    69060    AACCGAGTAATCCAATTTACTTTTCCTACTTTTTTTTCATTATCAATCGATTCAGATGCC  69119
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()