SEC2/YNL272C Locus History Help


Nomenclature History
Standard Name Reference
SEC2 Novick P, et al.  (1980) Identification of 23 complementation groups required for post-translational events in the yeast secretory pathway. Cell 21(1):205-15 Fields, C. and Schekman, R.  (1985) Personal Communication, Mortimer Map Edition 9
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide deletion was made in the intergenic region between ORFs SEC2/YNL272C and BNI1/YNL271C.
New    129240  TAAACGAGAGCCATGTTTTAAAGGTGCTTCAGCGAACGC-GAAATACAAGTTCCGGGTAG  129298
               ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Old    129240  TAAACGAGAGCCATGTTTTAAAGGTGCTTCAGCGAACGCAGAAATACAAGTTCCGGGTAG  129299
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()