SLA2/YNL243W Locus History Help


Nomenclature History
Standard Name Reference
SLA2 Holtzman DA, et al.  (1993) Synthetic-lethal interactions identify two novel genes, SLA1 and SLA2, that control membrane cytoskeleton assembly in Saccharomyces cerevisiae. J Cell Biol 122(3):635-44
Other Name(s)Reference
END4 Wesp A, et al.  (1997) End4p/Sla2p interacts with actin-associated proteins for endocytosis in Saccharomyces cerevisiae. Mol Biol Cell 8(11):2291-306 Raths S, et al.  (1993) end3 and end4: two mutants defective in receptor-mediated and fluid-phase endocytosis in Saccharomyces cerevisiae. J Cell Biol 120(1):55-65
MOP2 Na S, et al.  (1995) MOP2 (SLA2) affects the abundance of the plasma membrane H(+)-ATPase of Saccharomyces cerevisiae. J Biol Chem 270(12):6815-23
Nomenclature History Notes
DateNote
2001-12-27This gene has been referred to as UFG1 in Genbank entry U07938.1.
Sequence Annotation Notes
DateNote
2011-02-03Nucleotide change(s) in the coding region of SLA2/YNL243W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 344 is now Alanine rather than Arginine.
New    189059  ATCCCCACTGCCACTGGTGCAGCTAACGCCATTTTTCCACAGGCGACGGCACAAATGCAG  189118
               |||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||
Old    189060  ATCCCCACTGCCACTGGTGCACGTAACGCCATTTTTCCACAGGCGACGGCACAAATGCAG  189119
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()