- Summary
- Locus History
- Literature
- Gene Ontology
- Phenotype
- Interactions
- Expression
- Protein
- Wiki
| Nomenclature History | |
|---|---|
| Standard Name | Reference |
| SLA2 | Holtzman DA, et al. (1993) Synthetic-lethal interactions identify two novel genes, SLA1 and SLA2, that control membrane cytoskeleton assembly in Saccharomyces cerevisiae. J Cell Biol 122(3):635-44 |
| Other Name(s) | Reference |
|---|---|
| END4 | Wesp A, et al. (1997) End4p/Sla2p interacts with actin-associated proteins for endocytosis in Saccharomyces cerevisiae. Mol Biol Cell 8(11):2291-306 Raths S, et al. (1993) end3 and end4: two mutants defective in receptor-mediated and fluid-phase endocytosis in Saccharomyces cerevisiae. J Cell Biol 120(1):55-65 |
| MOP2 | Na S, et al. (1995) MOP2 (SLA2) affects the abundance of the plasma membrane H(+)-ATPase of Saccharomyces cerevisiae. J Biol Chem 270(12):6815-23 |
| Nomenclature History Notes | |
|---|---|
| Date | Note |
| 2001-12-27 | This gene has been referred to as UFG1 in Genbank entry U07938.1. |
| Sequence Annotation Notes | |
|---|---|
| Date | Note |
| 2011-02-03 | Nucleotide change(s) in the coding region of SLA2/YNL243W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 344 is now Alanine rather than Arginine.
New 189059 ATCCCCACTGCCACTGGTGCAGCTAACGCCATTTTTCCACAGGCGACGGCACAAATGCAG 189118
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Old 189060 ATCCCCACTGCCACTGGTGCACGTAACGCCATTTTTCCACAGGCGACGGCACAAATGCAG 189119 |
| Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. () | |



