APC1/YNL172W Locus History Help


Nomenclature History
Standard Name Reference
APC1 Zachariae W, et al.  (1996) Identification of subunits of the anaphase-promoting complex of Saccharomyces cerevisiae. Science 274(5290):1201-4
Sequence Annotation Notes
DateNote
2011-02-03Nucleotide change(s) in the coding region of APC1/YNL172W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 1547 is now Methionine rather than Isoleucine.
New    315238  CCACATCCCTTACAAGAATTGAAGCATTTCTGGAGCATGGCTGTAGAGCCTCGTTGCCTT  315297
               |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Old    315240  CCACATCCCTTACAAGAATTGAAGCATTTCTGGAGCATTGCTGTAGAGCCTCGTTGCCTT  315299
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()