MET4/YNL103W Locus History 
- Summary
- Locus History
- Literature
- Gene Ontology
- Phenotype
- Interactions
- Expression
- Protein
- Wiki
| Nomenclature History | |
|---|---|
| Standard Name | Reference |
| MET4 | Masselot M and De Robichon-Szulmajster H (1975) Methionine biosynthesis in Saccharomyces cerevisiae. I. Genetical analysis of auxotrophic mutants. Mol Gen Genet 139(2):121-32 |
| Sequence Annotation Notes | |
|---|---|
| Date | Note |
| 2006-11-09 | The systematic sequence is being updated within the ORF YNL103W with the following three transversions: C to G at chromosomal coordinate 429057, G to C at 429058, and G to C at 429061. These are nucleotide positions 1321, 1322, and 1325 within ORF YNL103W, changing amino acids 441 and 442 from Arg-Gly to Ala-Ala. Thanks to Phil Robinson in Roger Kornberg's lab for alerting SGD to these sequencing errors.
New: 1311 GGCTGAAACTGCTGCGCCAACTACCTTATCAACGTCGCCTTCGTTCAATGAGCACGGTGTAGTAGCAGAG 1380
|||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old: 429047 GGCTGAAACTCGTGGGCCAACTACCTTATCAACGTCGCCTTCGTTCAATGAGCACGGTGTAGTAGCAGAG 429116 |
| Mapping Notes | |
|---|---|
| Date | Note |
| 1994-08-01 | Edition 12: leu4, met4 and pol1 (cdc17) are adjacent genes with pol1 closest to the centromere |
| Mortimer RK, et al. (1994) "Genetic and Physical maps of Saccharomyces cerevisiae (Edition 12)". Pp. 374-377 in 1994 Yeast Genetics and Molecular Biology Meeting Program and Abstracts. Bethesda, MD: The Genetics Society of America | |
