SAL1/YNL083W Locus History Help


Nomenclature History
Standard Name Reference
SAL1 Chen XJ  (2004) Sal1p, a calcium-dependent carrier protein that suppresses an essential cellular function associated With the Aac2 isoform of ADP/ATP translocase in Saccharomyces cerevisiae. Genetics 167(2):607-17
Sequence Annotation Notes
DateNote
2004-02-18Brachat et al. 2003 predicted the extension of the 3' end of YNL083W based on the automated comparison of related fungi. Belenkiy et al. 2000 had previously confirmed the sequence change in strain CG379. The sequence is available in GenBank (accession number AF419344). As a consequence, YNL083W was extended in the 3' end, increasing the size of the predicted protein from 494 amino acids to 545 amino acids. This C-terminal extension is also conserved in S. bayanus, S. mikatae, S. paradoxus, and S. kluyveri.
   New:        GAACTTAATCATGAACTTTCAAATGAAAAGATGAACAAATTCTCGAGGTTTTTTGAATGG
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 471734 GAACTTAATCATGAACTTTCAAATGAAAAGGTGAACAAATTCTCGAGGTTTTTTGAATGG 471793

   New:        GTGGGC-TCAGATTATTTTACAGAGGTGTCACAGTCGGTATAGTGGGCATATTTCCCTA
               | |||  ||||||||||||||||||||||||||||||||||||||||||||||||||||
 Sbjct: 472574 GGGGGGGTCAGATTATTTTACAGAGGTGTCACAGTCGGTATAGTGGGCATATTTCCCTA 472633
Belenkiy R, et al.  (2000) The yeast mitochondrial transport proteins: new sequences and consensus residues, lack of direct relation between consensus residues and transmembrane helices, expression patterns of the transport protein genes, and protein-protein interactions with other proteins. Biochim Biophys Acta 1467(1):207-18
Brachat S, et al.  (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
2010-01-05SAL1 contains a frameshift mutation (the sal1-1 allele) in certain laboratory strains, including S288C. The sal1-1 frameshift mutation results in the encoding of missense amino acids starting with the 403rd codon, and truncates the protein to 494 amino acids from its "wild-type" length in other strains of 545 amino acids.

The annotation of SAL1 was altered in SGD in February 2004 away from the sal1-1 allele after sequence comparisons to related fungi (Belenkiy et al. 2000; Brachat et al. 2003). Dimitrov et al. (2009) sequenced the SAL1 gene from strains BY4716 and S288C, and discovered that these strains do both indeed contain the sal1-1 allele despite the previous annotation change in SGD. The correct annotation of SAL1 has now been reinstated in SGD.

Chen XJ  (2004) Sal1p, a calcium-dependent carrier protein that suppresses an essential cellular function associated With the Aac2 isoform of ADP/ATP translocase in Saccharomyces cerevisiae. Genetics 167(2):607-17
Smith CP and Thorsness PE  (2008) The Molecular Basis for Relative Physiological Functionality of the ADP/ATP Carrier Isoforms in Saccharomyces cerevisiae. Genetics 179(3):1285-99
Dimitrov LN, et al.  (2009) Polymorphisms in multiple genes contribute to the spontaneous mitochondrial genome instability of Saccharomyces cerevisiae S288C strains. Genetics 183(1):365-83