YML122C Feature History Help

Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide was inserted in the intergenic region between ORFs YML122C and GTR1/YML121W.
New    26580   TTTTATTGAATCTTTTTTTTTTTGTAAGAAAATTAAGGTTTATTAGGCAGAGTATACCGA  26639
               |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Old    26581   TTTTATTGAATCTTTTTTTTTT-GTAAGAAAATTAAGGTTTATTAGGCAGAGTATACCGA  26639
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()