LEU3/YLR451W Locus History Help


Nomenclature History
Standard Name Reference
LEU3 Baichwal VR, et al.  (1983) Leucine biosynthesis in yeast : Identification of two genes (LEU4, LEU5) that affect alpha-Isopropylmalate synthase activity and evidence that LEU1 and LEU2 gene expression is controlled by alpha-Isopropylmalate and the product of a regulatory gene. Curr Genet 7(5):369-77
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide deletion was made in the intergenic region between ORFs LEU3/YLR451W and SST2/YLR452C.
New    1038716  TTTTAATGAATGAATTTGCGTTCAATCCCAAGGTTTAAAGTCCTTTTCTTTTTTTG-CGTAATGTTTACT  1038784
                |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Old    1038713  TTTTAATGAATGAATTTGCGTTCAATCCCAAGGTTTAAAGTCCTTTTCTTTTTTTGCCGTAATGTTTACT  1038782
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
Mapping Notes
DateNote
1989-10-01Edition 10: leu3 is adjacent to sst2 on the basis of sequencing data

Mortimer RK, et al.  (1989) Genetic map of Saccharomyces cerevisiae, edition 10. Yeast 5(5):321-403