VMA6/YLR447C Locus History Help


Nomenclature History
Standard Name Reference
VMA6 SGD  (2007) Information without a citation in SGD ()
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide insertion was made in the intergenic region between ORFs VMA6/YLR447C and RPL6B/YLR448W.
New    1028577  TAACCTGGACTTGCCGTGCTAAGTCGGCCTTCTAGGCTGCGCTTCCGTTCAGCATCGTTT  1028636
                |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Old    1028574  TAACCTGGACTTGCCGTGCTAAGTCGGCCTTCTA-GCTGCGCTTCCGTTCAGCATCGTTT  1028632
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()