EST2/YLR318W Locus History Help


Nomenclature History
Standard Name Reference
EST2 Lendvay TS, et al.  (1996) Senescence mutants of Saccharomyces cerevisiae with a defect in telomere replication identify three additional EST genes. Genetics 144(4):1399-412
Nomenclature History Notes
DateNote
2003-02-12The name EST2 was once used by Fukuda, K, et al. (1998) for the gene now referred to as IAH1/YOR126C, an isoamyl acetate-hydrolyzing esterase. The EST2 name is generally used for the gene EST2/YLR318W, encoding the catalytic subunit of telomerase.

Fukuda K, et al.  (1998) Brewing properties of sake yeast whose EST2 gene encoding isoamyl acetate-hydrolyzing esterase was disrupted J Ferment Bioeng 85(1):101-106
2003-12-09The name EST2 has been used to describe both EST2/YLR318W, the catalytic subunit of telomerase, and IAH1/YOR126C, an isoamyl acetate-hydrolyzing esterase.
Sequence Annotation Notes
DateNote
2011-02-03Nucleotide change(s) in the coding region of EST2/YLR318W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 162 is now Alanine rather than Valine.
New    766978   AAATCGTGGGTAACAGATGTAACGAACCTCATCTGCCGCCCAAATGGGCTCAACGATCATCCTCATCATC  767047
                ||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||
Old    766978   AAATCGTGGGTAACAGATGTAACGAACCTCATCTGCCGCCCAAATGGGTCCAACGATCATCCTCATCATC  767047
Dietrich F  (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. ()
Mapping Notes
DateNote
1996-09-21Edition 13: The gene name EST2 has also been used to refer to the IAH1 isoamyl acetate hydrolytic enzyme gene located on chromosome XV

Cherry JM, et al.  (1996) "Genetic and Physical Maps of Saccharomyces cerevisiae (Edition 13)". Pp. 361-364 in 1996 Yeast Genetics and Molecular Biology Meeting Program and Abstracts. Bethesda, MD: The Genetics Society of America