IMH1/YLR309C Locus History Help


Nomenclature History
Standard Name Reference
IMH1 Li B and Warner JR  (1996) Mutation of the Rab6 homologue of Saccharomyces cerevisiae, YPT6, inhibits both early Golgi function and ribosome biosynthesis. J Biol Chem 271(28):16813-9
Other Name(s)Reference
SYS3 Tsukada M and Gallwitz D  (1996) Isolation and characterization of SYS genes from yeast, multicopy suppressors of the functional loss of the transport GTPase Ypt6p. J Cell Sci 109 ( Pt 10)():2471-81
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide substitution was made within ORF IMH1/YLR309C. Note that the protein sequence was not changed.
New    750178   TCACTAAATTGTTTAACTTGTTCCTCCAAGTAACTCACAGTTTTTTCCTTTTGTTTATAA  750237
                |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Old    750180   TCACTAAATTGTTTAACTTGTTCCTCCAAGTAACTCACAGTTTTCTCCTTTTGTTTATAA  750239
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()