SNF7/YLR025W Locus History 
- Summary
- Locus History
- Literature
- Gene Ontology
- Phenotype
- Interactions
- Expression
- Protein
- Wiki
| Nomenclature History | |
|---|---|
| Standard Name | Reference |
| SNF7 | Vallier LG and Carlson M (1991) New SNF genes, GAL11 and GRR1 affect SUC2 expression in Saccharomyces cerevisiae. Genetics 129(3):675-84 |
| Other Name(s) | Reference |
|---|---|
| DID1 | Amerik AY, et al. (2000) The Doa4 deubiquitinating enzyme is functionally linked to the vacuolar protein-sorting and endocytic pathways. Mol Biol Cell 11(10):3365-80 |
| RNS4 | Unno K, et al. (2005) Identification and characterization of rns4/vps32 mutation in the RNase T1 expression-sensitive strain of Saccharomyces cerevisiae: Evidence for altered ambient response resulting in transportation of the secretory protein to vacuoles. FEMS Yeast Res 5(9):801-12 |
| VPL5 | Raymond CK, et al. (1992) Morphological classification of the yeast vacuolar protein sorting mutants: evidence for a prevacuolar compartment in class E vps mutants. Mol Biol Cell 3(12):1389-402 |
| VPS32 | Robinson JS, et al. (1988) Protein sorting in Saccharomyces cerevisiae: isolation of mutants defective in the delivery and processing of multiple vacuolar hydrolases. Mol Cell Biol 8(11):4936-48 |
| Nomenclature History Notes | |
|---|---|
| Date | Note |
| 2009-04-21 | The VPL5 name was originally associated with VPS5/YOR069W. However, further complementation analysis indicated that the vpl5 mutant is actually allelic to SNF7/YLR025W, also known as VPS32. |
| Robinson JS, et al. (1988) Protein sorting in Saccharomyces cerevisiae: isolation of mutants defective in the delivery and processing of multiple vacuolar hydrolases. Mol Cell Biol 8(11):4936-48 | |
| Rothman JH, et al. (1989) Characterization of genes required for protein sorting and vacuolar function in the yeast Saccharomyces cerevisiae. EMBO J 8(7):2057-65 | |
| Raymond CK, et al. (1992) Morphological classification of the yeast vacuolar protein sorting mutants: evidence for a prevacuolar compartment in class E vps mutants. Mol Biol Cell 3(12):1389-402 | |
| Sequence Annotation Notes | |
|---|---|
| Date | Note |
| 2011-02-03 | A single nucleotide substitution was made in the intergenic region between ORFs UBR2/YLR024C and SNF7/YLR025W.
New 193439 ATTGAAAGTATGAATGCGTTGATTATTGGGTTTCTCCCCACAGCTGTACATTGACGATGC 193498
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Old 193440 ATTGAAAGTATGAATGCGTTGATTATTGGGTTTCTCCCCACAGATGTACATTGACGATGC 193499 |
| Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. () | |
| Mapping Notes | |
|---|---|
| Date | Note |
| 1994-08-01 | Edition 12: snf7 is different from spt8 based on sequence analysis |
| Mortimer RK, et al. (1994) "Genetic and Physical maps of Saccharomyces cerevisiae (Edition 12)". Pp. 374-377 in 1994 Yeast Genetics and Molecular Biology Meeting Program and Abstracts. Bethesda, MD: The Genetics Society of America | |
