SNF7/YLR025W Locus History Help


Nomenclature History
Standard Name Reference
SNF7 Vallier LG and Carlson M  (1991) New SNF genes, GAL11 and GRR1 affect SUC2 expression in Saccharomyces cerevisiae. Genetics 129(3):675-84
Other Name(s)Reference
DID1 Amerik AY, et al.  (2000) The Doa4 deubiquitinating enzyme is functionally linked to the vacuolar protein-sorting and endocytic pathways. Mol Biol Cell 11(10):3365-80
RNS4 Unno K, et al.  (2005) Identification and characterization of rns4/vps32 mutation in the RNase T1 expression-sensitive strain of Saccharomyces cerevisiae: Evidence for altered ambient response resulting in transportation of the secretory protein to vacuoles. FEMS Yeast Res 5(9):801-12
VPL5 Raymond CK, et al.  (1992) Morphological classification of the yeast vacuolar protein sorting mutants: evidence for a prevacuolar compartment in class E vps mutants. Mol Biol Cell 3(12):1389-402
VPS32 Robinson JS, et al.  (1988) Protein sorting in Saccharomyces cerevisiae: isolation of mutants defective in the delivery and processing of multiple vacuolar hydrolases. Mol Cell Biol 8(11):4936-48 Rothman JH, et al.  (1989) Characterization of genes required for protein sorting and vacuolar function in the yeast Saccharomyces cerevisiae. EMBO J 8(7):2057-65
Nomenclature History Notes
DateNote
2009-04-21The VPL5 name was originally associated with VPS5/YOR069W. However, further complementation analysis indicated that the vpl5 mutant is actually allelic to SNF7/YLR025W, also known as VPS32.

Robinson JS, et al.  (1988) Protein sorting in Saccharomyces cerevisiae: isolation of mutants defective in the delivery and processing of multiple vacuolar hydrolases. Mol Cell Biol 8(11):4936-48
Rothman JH, et al.  (1989) Characterization of genes required for protein sorting and vacuolar function in the yeast Saccharomyces cerevisiae. EMBO J 8(7):2057-65
Raymond CK, et al.  (1992) Morphological classification of the yeast vacuolar protein sorting mutants: evidence for a prevacuolar compartment in class E vps mutants. Mol Biol Cell 3(12):1389-402
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide substitution was made in the intergenic region between ORFs UBR2/YLR024C and SNF7/YLR025W.
New    193439   ATTGAAAGTATGAATGCGTTGATTATTGGGTTTCTCCCCACAGCTGTACATTGACGATGC  193498
                ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Old    193440   ATTGAAAGTATGAATGCGTTGATTATTGGGTTTCTCCCCACAGATGTACATTGACGATGC  193499
Dietrich F  (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. ()
Mapping Notes
DateNote
1994-08-01Edition 12: snf7 is different from spt8 based on sequence analysis

Mortimer RK, et al.  (1994) "Genetic and Physical maps of Saccharomyces cerevisiae (Edition 12)". Pp. 374-377 in 1994 Yeast Genetics and Molecular Biology Meeting Program and Abstracts. Bethesda, MD: The Genetics Society of America