AAD10/YJR155W Locus History Help


Nomenclature History
An SGD Standard Name was first assigned to this gene on 2000-11-14.
Standard Name Reference
AAD10 Delneri D, et al.  (1999) Analysis of the seven-member AAD gene set demonstrates that genetic redundancy in yeast may be more apparent than real. Genetics 153(4):1591-600
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide substitution was made within the intergenic region between ORFs YJR154W and AAD10/YJR155W.
New    727077  GTTGGGGACTGGTTAATTAATTGAATAGCTTCATAACCCACCGCCGCAAAATGTGCTCTT  727136
               ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Old    727067  GTTGGGGACTGGTTAATTAATTGAATAGCTTCATAACCCACCGCCCCAAAATGTGCTCTT  727126
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()