DAL5/YJR152W Locus History Help


Nomenclature History
Standard Name Reference
DAL5 Chisholm VT, et al.  (1987) Regulation of allantoate transport in wild-type and mutant strains of Saccharomyces cerevisiae. J Bacteriol 169(4):1684-90
Other Name(s)Reference
UREP1 Drillien R and Lacroute F  (1972) Ureidosuccinic acid uptake in yeast and some aspects of its regulation. J Bacteriol 109(1):203-8
Sequence Annotation Notes
DateNote
2011-02-03Two separate single nucleotide substitutions were made in the intergenic region between ORFs YJR151W-A and DAL5/YJR152W.
New    717672  AAAAAAAAAACCAGATCTGTTGATCAGTTGTAATCGTGTAAACGAGTACAAAAGGCCAGA  717731
               ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Old    717662  AAAAAAAAACCCAGATCTGTTGATCAGTTGTAATCGTGTAAACGAGTACAAAAGGCCAGA  717721
New    717732  GACAGCTTCTACTCCAAGCTTAAGATACGTATACACAAAAGATTTTTACTTGAAGGAGTA  717791
               ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Old    717722  GACAGCTTCTACTCCAAGCTTAAGATACGTATACACAAAAGATTTTTACTTGAGGGAGTA  717781
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
2011-02-03A single nucleotide substitution was made within the intergenic region between ORFs DAL5/YJR152W and PGU1/YJR153W.
New    722267  CCGGATATGAGTAAGAGTGATCTTGCCGTAGAGATAATAGCTGCACAAAGGCCAAGGATT  722326
               |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Old    722257  CCGGATATGAGTAAGAGTGATCTTGCCGGAGAGATAATAGCTGCACAAAGGCCAAGGATT  722316
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
Mapping Notes
DateNote
1989-10-01Edition 10: dal5 is allelic to urep1

Mortimer RK, et al.  (1989) Genetic map of Saccharomyces cerevisiae, edition 10. Yeast 5(5):321-403