DAN1/YJR150C Locus History Help


Nomenclature History
Standard Name Reference
DAN1 Sertil O, et al.  (1997) The DAN1 gene of S. cerevisiae is regulated in parallel with the hypoxic genes, but by a different mechanism. Gene 192(2):199-205
Other Name(s)Reference
CCW13 Mrsa V, et al.  (1999) Deletion of new covalently linked cell wall glycoproteins alters the electrophoretic mobility of phosphorylated wall components of Saccharomyces cerevisiae. J Bacteriol 181(10):3076-86
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide substitution within the coding region of DAN1/YJR150C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 115 is now Glutamic Acid rather than Glycine.
New    709317  TGGAAGAAGCCTCTGTGGTAGAAGCTGGTACTGCAGTAGCAATACCTTCATTCGCAAGTG  709376
               ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Old    709307  TGGAAGAAGCCTCTGTGGTAGAAGCTGGTACTGCAGTAGCAATACCTCCATTCGCAAGTG  709366
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
2011-02-03A single nucleotide substitution was made within the intergenic region between ORFs YJR149W and DAN1/YJR150C.
New    708407  GACACAAATTTTCTGGATGACCTTTTTCTATATGATATATATACGTCGCTATTGGATCGT  708466
               ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Old    708397  GACACAAATTTTCTGGATGACCTTTTTCTATATGATATATAAACGTCGCTATTGGATCGT  708456
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()